Variation & Race:

1. The environmental stress from cold weather and extremely low temperatures negatively affects the survival of humans (and other organisms) by disturbing homeostasis. Homeostasis is where variables are regulated so that the internal conditions of an organism remain stable and relatively constant regardless of the outside environment. The effect of low temperatures can mostly be seen by the two main responses to the cold: those that retain heat and those that increase heat production. There are many ways to fight the cold such as shivering and voluntary exercise, although there are negative effect of these methods because they require an increased intake of nutrients to provide needed energy.

2. Reactions to cold weather and extreme low temperatures can be seen through developmental adaptions and short term responses. Developmental adaptions are actual changes in the DNA of a population of individuals in response to a long-term stress (in this case, cold temperatures) to produce a phenotypic change through evolutionary forces. The population changes over generations.

• Heat Retention: More efficient than heat production because it requires less energy. Energy is obtained from dietary sources and unless food is abundant, any factor that conserves energy can be beneficial.
• Metabolic Rate Increase & Shivering: Increases in metabolic rate and shivering are short-term responses that generate body heat. Increases in metabolic rate (the rate at which cells break up nutrients) release energy in the form of heat. Shivering also generates muscle heat, as does voluntary exercise. As mentioned before, these actions pose a threat because large amounts of nutrients are required to provide more energy to complete these actions.
• Vasoconstriction: Another short-term response to extreme cold temperatures. Instead of producing heat like the previous mechanisms, it minimizes heat loss and therefore is more energy efficient. Vasoconstriction differs from vasodilation (used in extreme heat) as it restricts capillary blood flow to the surface of the skin, thus reducing heat loss at the body surface. Creating body heat is more economical than creating it, therefore vasoconstriction is very efficient in above freezing temperatures. However, if temperatures drop to below freezing levels, vasoconstriction can serve as a negative response which will ultimately lower the skin temperature to the point of frostbite or potentially worse.
• Weight & Height: In general, people exposed to chronic cold (the majority of the year) maintain higher metabolic rates than people who live in warmer climates. Diets that consist of high animal protein and fat diet serve to maintain high metabolic rates required by exposure to chronic cold. In general, the body shape tendency of populations living in cold climates is to be squat and round, allowing individuals to retain more heat in their body core.

                        






                         


3. There are many benefits of studying human variation from the perspective across environmental clines rather than basing it off of race. Through the use of clines, we are able to see how different races and species adapted to certain environmental stresses. A benefit to using information from explorations like this is that we can see natural selection in action. This information can be used in a productive way by helping us learn about learn more about the human species and how exactly they react and adapt to these stresses (heat, cold, high altitude, etc.)

4. In Biology, the term race refers to geographically pattern phenotypic variation within a species. Up until the twenty-first century, race was used to express human variation of environmental stresses, but now scientists study human variation over environmental clines. I can use race to understand the variation of the adaptations listed in #2 because certain races have specific habits and rituals, such as their diet and eating patterns (bullet 4; #2).

The study of environmental influences on adaptions is a better way to understand human variation than by the use of race because there is major limitation of traditional classification by means of race. These traditional ways are inherently typological thus categorizing things based on stereotypes or ideals that comprise a specific set of traits. These beliefs and typologies are often incorrect because any grouping made will always include some individuals that do not conform to every single aspects of a particular race.

The Piltdown Hoax

1:The Piltdown Hoax occurred during a prime discovery of (believed to be at the time) human fossils by the British paleontologist, Charles Dawson, dating in 1912. Dawson, along with Woodward, an archeologist, and French priest Teilhard de Chardin, managed one day to find fossils that were believed to be representative of a human being. When first observed, the fossil in question was that of a deteriorating jaw bone, making note of the flat and smooth molars. This was a massive achievement due to how very little was known of human fossil remains at the time in Britain; it was a great leap towards proving that Charles Darwin's theory of evolution was correct. However, in the year 1953, news hit that "Piltdown" man, as the fossil was termed, was actually a fake! When tested, it had been confirmed that the fossil was indeed a makeshift; the jaw and skull were actually stained, while the teeth were filed down to appear as though they belonged to a human. This place major criticism upon British scientists, labeled as being gullible and impractical in their length of analyzation of the Piltdown man.


2: Indeed, many times have our faults as human beings display malpractice or bias within the scientific community. Although it is true that scientists in modern days make an effort to keep them away, examples such as the Piltdown Hoax serve to show that scientists are capable of great mistakes and error. The human faults of over-observation and that of under-analyzing cost the British scientists a lengthy and proper analysis, to which they would not have been discredited and ridiculed as they are in modern day. In the haste and moment of discovery, we as humans lean on recognition without speculation or second guessing. This is what I believe the Piltdown Hoax is a good representation of.


3: The scientific observation of the Piltdown man were taken over a full series of experiments and tests. One such portion of these tests was a fluorine absorption test, which ultimately proved that the Piltdown man fossil had been stained to mark its appearance. It is unknown why the skull was stained, interestingly enough, but it is also intriguing to notice that not a single scientist had realized this issue prior to the discovery that the fossil was indeed a hoax. Another such test was the the view of the teeth located on the mandible under microscopic view. The teeth were found to have been filed down to create a flat look resembling the structure of human teeth; scratches were found on the individual teeth, likely the product of scraping done by some sort of tool.


4: Through the use of technology would be the only way I can see the "human" factor being removed from scientific studies. Computers can be assigned randomization codes that could observe several process randomly and assert probabilities over theories that we as humans have observed. The technology would be capable of removing bias from the study provided that the humans who input the data are not placing in biased data itself. I believe that to reach the truest form of a theory or understanding of a field of science, removal of the human factor is necessary so that we cannot bias ourselves or create a margin of error. Perfect science does not bend to the view of humans; it should not bend to any factors other than those that create it.


5: Perhaps the most basic view is that we are not to take observations at base values, especially within a scientific field. Dawson has had his name tarnished for the rest of written history due to this oversight in the onset of discovery. In the excitement, we must remember to be practical and overlook no boundaries in our discoveries. It is better to take the long road and figure out all points of analysis before boldly proclaiming limited information.

Analogy / Homology

Homologous traits are those that are shared between two different species. This means that they have shared a common ancestor that passed on said trait onto the individual species. The structure may be somewhat different, but they still bear the same underlying anatomy.

Analogous traits are those that, although similar, are not due to species bearing a common ancestor, but rather due to similar environmental pressures bearing down on both species to develop that trait to a similar state.

Question 1:

A: The homologous trait discussed would  the forearms of gorillas and those of humans.

B: Both species bear a hand and forearm consisting of a humerus, ulna, and radius, with multiple carpals and metacarpals conjoining the hand to the forearm. These bones are found to have relatively the same structural assignments to each part of the forearm. The bones of a gorilla are somewhat larger than those of humans, however. This may be due to a change in the environment that affected survival (gorillas may need more arm length to climb, gather food, etc... whereas humans have no need to do such).

C: Humans and gorillas share roughly 96% of their genes. It is believed that gorillas and humans bore a common ancestor roughly 10 million years ago, during the slow rise of the great apes variation. The assumption was taken after a study focusing on gorillas in the western lowlands.

D: An image comparing the hand structure and forearm development:
http://media-1.web.britannica.com/eb-media/95/55495-004-84E08ECB.jpg


Question 2:

A: The analogous traits discussed would be the dorsal  fin of a shark as compared to that of a dolphin.

B: Shark fins are heavily rigid, and composed of cartilage. The dorsal fin is meant to lift the shark, keep it stable as it swims, and aid in propelling the shark forward. The dorsal fin of a dolphin, however, are made of a connective tissue and helps with keeping the dolphin in it's upright position. A side note, the dorsal fin is also capable of releasing excess heat. The major point is that they aid in maintaining balance for the creature and help in mobility.

C: This trait is indeed analogous, evolving independently. The original ancestor had no need for the dorsal fin, as the environment had not required some adaption to such, or perhaps that the dorsal fin was the evolutionary reaction gained form an additional fin to aid in support. Again, the common ancestor must have not had a need for such at the time.

D: An image comparing the outer anatomical structures of the sharks vs. the dolphins
http://evolution.berkeley.edu/evolibrary/images_pamphlets/sharkdolphin2.jpg

GGCTACCAAGATCTTACTGTGTGAACATCTATCCGA

Historical Influence of Cuvier on Darwin

1: I argue that the works of Georges Cuvier is a more highly notable influence of the works of Darwin. He serves as a positive influence in regards to Darwin's comparative studies.



2: French zoologist Georges Cuvier, born in the late 18th century, is well known for his studies and correlations between four types of beings, of which he termed vertebrates, mollusks, articulates, and radiates. He is most noted, however, for his works on comparative anatomy through the use of paleontology, as well as early attempts at recreating extinct species through the studies of individual fossil parts.

3: Who gets better access to limited resources?



A: Darwin's notes hypothesized that creatures who are better adapted to the environment will gain greater control of resources within their habitat. Cuvier believed that bearing specific adaptations required pre-requisite evolutionary traits that are linked to one another. For example, having sharp teeth in a carnivore requires that they have strong and mature bones as well as capable jaw muscles and force upon biting, or that a swift animal bear more flexible joint muscles and are relatively light. By having a single characteristic evolve, creatures in turn alter traits or structures adjacent to the one they are originally altering; this allows for evolutionary adaptations that aid in a creature's attempt to control environmentally limited resources better.






4: I feel that Darwin could have developed his theory of natural selection, although not nearly as completed without the works of Cuvier. This is due to Cuvier's specialty of comparison between similar species, a work that Darwin further advanced in his studies. The law of co-ordinance structured by Cuvier, listed in the answer for #3, also serves as a key point for Dawin's theory to be fully detailed.






#5: Darwin made known his studies of natural selection within On the Origin of Species. While making it the best seller of its year, it received heavy criticism from scientists, traditionalists, and especially the churches, which refuted Darwin's studies with the still prevalent creationist theories of the time. Before publication, however, he was noted for some fears concerning forms of religious prosecution as well as protest from his pious wife. Despite the pressure from the church and opposing scientists, the book was published and released in 1859.






Source: http://www.cosmovisions.com/Williams040501.htm

Desert Island

If you were stranded on a desert island, what two items would you take with you and why?

     The idea of stranded on a lone island implies that I must ultimately gain a sense of survival; the first would be a book addressing key survival methods, such as creating hunting equipment, building and fortifying a shelter, food preservation, detoxifying water, etc...

     The second item would be a little more personal, say a Bible or the works of a famous philosopher, anything really that would hinder logical and moral degradation. It is not enough that my body should survive; my mentality is also my identity, and I would dare not give it up.